• Users Online: 261
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
CASE REPORT
Year : 2017  |  Volume : 19  |  Issue : 1  |  Page : 59-61

Lichtheimia ramosa isolated from a young patient from an infected wound after a road traffic accident


Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Chennai, Tamil Nadu, India

Date of Web Publication15-Jun-2017

Correspondence Address:
Anupma Jyoti Kindo
Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Porur, Chennai - 600 016, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jacm.jacm_3_17

Rights and Permissions
  Abstract 

A 38 year-old male, a known case of diabetes mellitus on treatment, sustained an injury to his left foot in a Road Traffic Accident (RTA) and developed a polymicrobial wound infection. The causative organisms were found to be Pseudomonas aeruginosa along with a Zygomycete which could not be speciated by conventional microscopy but was identified as Lichtheimia ramosa by Polymerase Chain Reaction (PCR) and Internal Transcribed Spacer (ITS)sequencing. The infection was treated successfully by debridement and daily dressing with antiseptic solution. The patient recovered due to early diagnosis and did not require systemic antifungals.

Keywords: Diabetes mellitus, fungal infection, road traffic accident


How to cite this article:
Neelaveni V, Tupaki-Sreepurna A, Thanneru V, Kindo AJ. Lichtheimia ramosa isolated from a young patient from an infected wound after a road traffic accident. J Acad Clin Microbiol 2017;19:59-61

How to cite this URL:
Neelaveni V, Tupaki-Sreepurna A, Thanneru V, Kindo AJ. Lichtheimia ramosa isolated from a young patient from an infected wound after a road traffic accident. J Acad Clin Microbiol [serial online] 2017 [cited 2022 Jan 28];19:59-61. Available from: https://www.jacmjournal.org/text.asp?2017/19/1/59/208076


  Introduction Top


Mucormycosis is a potentially fatal fungal infection that occurs in immunocompromised patients, diabetic patients with ketoacidosis and immunocompetent patients after trauma and exposure to contaminated soil.[1] These filamentous fungi belong to the order Mucorales. About twenty different species have been shown to be pathogenic for humans.[2] Other genera causing mucormycosis are Rhizopus spp., Mucor spp., and Cunninghamella spp., while Apophysomyces elegans and Lichtheimia spp. are less commonly reported.[1] However, information on exact incidence of disease is limited because of several factors. The identification up to the species level needs expertise usually available only at reference laboratories.

In our case study, we describe a Lichtheimia ramosa mycosis in a patient who had severe traumatic injury to his left foot because of a road traffic accident (RTA). The etiological agent was identified morphologically and molecularly. Apart from Lichtheimia corymbifera, there is another species within the genus, L. ramosa which is responsible for mucormycosis in humans. These two species can be differentiated based on their molecular, biological and morphological characteristics.


  Case Report Top


A 38-year-old male hailing from Sankarapuram Taluk, Viluppuram District, Tamil Nadu State, India, had been admitted to our hospital with the complaints of ulcer over the left foot since one month. The patient gave a history of RTA a month back in his hometown where he sustained a laceration injury to the left foot which was sutured at the time without proper cleaning in a nearby local hospital. The patient was also a known case of diabetes mellitus since 20 years on regular oral anti-glycaemic medications. A general examination found the patient to be conscious, oriented, afebrile and normotensive with stable vitals. Systemic examination was found to be normal.

Local examination of the left foot showed a non-healing ulcer present in the plantar aspect of the left foot 7 cm × 3 cm × 2 cm, purulent discharge present, slough present [Figure 1]. A pus swab/aspirate was sent to the microbiology laboratory. The wound was subjected to daily thorough cleansing with antiseptic solution (Povidone-iodine 10%; Betadine) and surgical debridement every two to three days and left to heal by secondary intention.
Figure 1: Local examination of the left foot showing a non-healing ulcer present on the plantar aspect of the left foot 7 cm × 3 cm × 2 cm, purulent discharge present, slough present

Click here to view


Laboratory investigations

Gram stain of pus smear showed moderate number of pus cells and a few Gram-negative bacilli. The KOH mount of the specimen showed broad aseptate fungal elements. Pus culture grew Pseudomonas aeruginosa along with a mould. Specimen was collected under aseptic precautions and cultured on Sabouraud dextrose agar (SDA) and incubated at 37°C for four to five days which yielded a filamentous fungus with rapid growth. The growth on Potato dextrose agar was within 72 h; colonies were woolly, initially white and then changed to grey [Figure 2]a.
Figure 2: (a) Culture on Potato dextrose agar was fast growing, cottony to fluffy, white to yellow, becoming dark grey. (b) Microscopy of growth from Sabouraud dextrose agar medium showing branched sporangiophores arranged in umbel shape, usually at the terminals (×100). (c) Microscopy of growth from Sabouraud dextrose agar medium showing columella with prominent dome-shaped apophysis and hyaline spores (×100). (d) Microscopy of growth from Sabouraud dextrose agar medium showing abundant pleomorphic giant cells with finger-like projections submerged in agar (×100)

Click here to view


On SDA, fungus grew rapidly as cottony colonies after incubation at 37°C for 48 h. Microscopic examination showed branching aseptate broad hyphae. The sporangiophores were highly branched and terminated in sporangia or the columellar remnants. Most branches were arranged in umbel shape, usually at the terminals [Figure 2]b. In young colonies, circinate sporangiophores were seen under the microscope using a ×10 objective. No rhizoids were observed. The sporangia were hyaline, multispored and pyriform in shape. The columella had prominent flask-shaped apophysis which was dome shape [Figure 2]c. Hyaline sporangiospores found inside sporangia were smooth and ellipsoidal in shape.

Pleomorphic giant cells with finger-like projections were observed, submerged in the agar, which was a characteristic of this genus [Figure 2]d. Giant cells are seen in all species of Lichtheima. Giant cells are strongly swollen, branched or unbranched, often droplet-filled hyphae with thick, refractive walls. They are frequently septate and branched. Some giant cells possess projections. Based on the phenotypic characteristics, the isolate was reported as Lichtheimia species.

Molecular speciation

DNA extraction was done directly from the culture plate by an in-house column-based method. Polymerase chain reaction amplification of a partial region of the internal transcribed spacer (ITS) nuclear ribosomal RNA gene (ITS1, 5.8S rDNA, ITS2) was performed using the pan-fungal primers ITS1 (5’ TCC GTA GGT GAA CCT TGC GG 3’) and ITS4 (5’TCC TCC GCT TAT TGA TAT GC 3’). Gene sequencing was done at SciGenom Labs Pvt. Ltd., Cochin, Kerala, India. The ITS sequence identified the isolate to be L. ramosa and has been deposited in the National Center for Biotechnology Information GenBank database with accession number KX236396.

>LICH_ITS1.FORWARD_27720-1_8381, Trimmed_Sequence_(685 bp)CTGCCT TGTGCTGTAAATCTGGTTGTTGGCATAAAA ACCCTCCTTTTAGGAAACTTGTGCCA CTACTAAAATCTAGGCTGCTTGAAAAAAAAC ATATGGACCCTTCTTTCAGGAGACCT ATGTCTCGAGTCAAACCAAGCAAG GCAAGCCTTTGGGGCTCTAGTACTAACT ATCCCCAAAGGTGTTTATTCTTCTCGTGTAAACC ATGATGTACGAAAAAGTTAGTTGTTA ACTTAAAAACAACTCTTGGCAATGGAT CTCTTGGTTCTCGCATCGATGAA TAGCGTACCAAAGTGCGATAAT TATTGCGAC TTGCATTCATAGCGAATCATC CAGTTCTCTAACGCATCTTGCGCCT AGTAATCAATCTACTAGGCAC AGTTGTTTCATTATCTGCAACTACCA ATCAGTTCAACTTGGTTCTTTGAACCTAA CCGAGCTGGAAATGGGCTTGTGTTGATG GCATTCATTTGCTGTCATGGCCTTA AATACATTTAGTCCTAGGCAA TTGGCTTTATTCATTTGCCGGATGTAGAC TCTAGAGTGCCTGAGGAGCAACGACTTG GTTAGTGAGTTCATAATTCCAAGTCAATCAGTC TCTTCTTGAACTAGGTCTTAATCTTTACGG ACTAGCGAGAGGATCTAACTTGGGTCTTC TCTTAACAAACTCACATCTAGATCTGAA.


  Discussion Top


The genus Lichtheimia was recently revised on the basis of phylogenetical, physiological and morphological characteristics.[3] The thermotolerant species of L. corymbifera (formerly Absidia corymbifera), Lichtheimia blakesleeana and Lichtheimia hyalospora were placed in the new family Mycocladiaceae and the genus Mycocladus. More recently in the nomenclature correction, a family Lichtheimiaceae was created instead of Mycocladiaceae.[4] The genus Lichtheimia belongs to the order Mucorales and includes saprotrophs isolated from soil, decaying plant material or dung.[5],[6] Three out of five currently accepted species, namely, L. corymbifera, Lichtheimia ornata and Lichtheimia ramosa , are known to cause human infections (mucormycoses) predominantly in patients with impaired immune systems.[7] The majority of cases caused by Lichtheimia species relate to patients that are severely debilitated due to malignancies, poorly controlled diabetes or solid organ transplantation. Cutaneous, pulmonary, rhinocerebral, renal and disseminated infections as well as otomycosis have been described,[8] and hence, the spectrum of infections due to Lichtheimia spp. is similar to that of other members of the family Mucorales. Soil serves as habitat and spore reservoir for Lichtheimia species. Several cases are known where traumatic injuries contaminated with soil resulted in Lichtheimia infections in immunocompetent patient.[9] L. corymbifera was until recently, the only species in this genus known to be disease causing, and it accounts for approximately 5% of mucormycosis today.[10] However, the true prevalence is unclear.[11] The use of molecular identification [12] is important for an accurate assessment of the epidemiology.

In the present case, traumatic implantation of L. ramosa caused local mucormycosis in an immunocompetent patient. Although both medical and surgical treatment are usually required, in our case, the patient was diagnosed in an early stage and was successfully managed with surgical debridement combined with irrigation with amphotericin B, without the need for systemic antimycotics. Bibashi et al.[13] described a mycosis due to L. corymbifera in a young male patient with multiple traumatic fractures that were also healed by surgical debridement and revascularization only.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Garcia-Hermoso D, Hoinard D, Gantier JC, Grenouillet F, Dromer F, Dannaoui E. Molecular and phenotypic evaluation of Lichtheimia corymbifera (formerly Absidia corymbifera) complex isolates associated with human mucormycosis: Rehabilitation of L. ramosa. J Clin Microbiol 2009;47:3862-70.  Back to cited text no. 1
    
2.
Dannaoui E, Garcia-Hermoso D. The Zygomycetes. In: Kavanagh K, editor. New Insights in Medical Mycology. Dordrecht, Netherlands: Springer; 2007. p. 159-83. Available from: http://www.dx.doi.org/10.1007/978-1-4020-6397-8_7. [Last accessed on 2016 Dec 25].  Back to cited text no. 2
    
3.
Hoffmann K, Discher S, Voigt K. Revision of the genus Absidia (Mucorales, Zygomycetes) based on physiological, phylogenetic, and morphological characters; thermotolerant Absidia spp. form a coherent group, Mycocladiaceae fam. nov. Mycol Res 2007;111(Pt 10):1169-83.  Back to cited text no. 3
    
4.
Alastruey-Izquierdo A, Hoffmann K, de Hoog GS, Rodriguez-Tudela JL, Voigt K, Bibashi E, et al. Species recognition and clinical relevance of the zygomycetous genus Lichtheimia (syn. Absidia pro parte, Mycocladus). J Clin Microbiol 2010;48:2154-70.  Back to cited text no. 4
    
5.
Rüping MJ, Heinz WJ, Kindo AJ, Rickerts V, Lass-Flörl C, Beisel C, et al. Forty-one recent cases of invasive zygomycosis from a global clinical registry. J Antimicrob Chemother 2010;65:296-302.  Back to cited text no. 5
    
6.
Kobayashi M, Hiruma M, Matsushita A, Kawai M, Ogawa H, Udagawa S. Cutaneous zygomycosis: A case report and review of Japanese reports. Mycoses 2001;44:311-5.  Back to cited text no. 6
    
7.
Almaslamani M, Taj-Aldeen SJ, Garcia-Hermoso D, Dannaoui E, Alsoub H, Alkhal A. An increasing trend of cutaneous zygomycosis caused by Mycocladus corymbifer (formerly Absidia corymbifera): Report of two cases and review of primary cutaneous Mycocladus infections. Med Mycol 2009;47:532-8.  Back to cited text no. 7
    
8.
Sun HY, Aguado JM, Bonatti H, Forrest G, Gupta KL, Safdar N, et al. Pulmonary zygomycosis in solid organ transplant recipients in the current era. Am J Transplant 2009;9:2166-71.  Back to cited text no. 8
    
9.
Woo PC, Lau SK, Ngan AH, Tung ET, Leung SY, To KK, et al. Lichtheimia hongkongensis sp. nov. a novel Lichtheimia spp. associated with rhinocerebral, gastrointestinal, and cutaneous mucormycosis. Diagn Microbiol Infect Dis 2010;66:274-84.  Back to cited text no. 9
    
10.
Roden MM, Zaoutis TE, Buchanan WL, Knudsen TA, Sarkisova TA, Schaufele RL, et al. Epidemiology and outcome of zygomycosis: A review of 929 reported cases. Clin Infect Dis 2005;41:634-53.  Back to cited text no. 10
    
11.
Kontoyiannis DP, Lionakis MS, Lewis RE, Chamilos G, Healy M, Perego C, et al. Zygomycosis in a tertiary-care cancer center in the era of Aspergillus-active antifungal therapy: A case-control observational study of 27 recent cases. J Infect Dis 2005;191:1350-60.  Back to cited text no. 11
    
12.
Balajee SA, Sigler L, Brandt ME. DNA and the classical way: Identification of medically important molds in the 21st century. Med Mycol 2007;45:475-90.  Back to cited text no. 12
    
13.
Bibashi E, de Hoog GS, Pavlidis TE, Symeonidis N, Sakantamis A, Walther G. Wound infection caused by Lichtheimia ramosa due to a car accident. Med Mycol Case Rep 2012;2:7-10.  Back to cited text no. 13
    


    Figures

  [Figure 1], [Figure 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Case Report
Discussion
References
Article Figures

 Article Access Statistics
    Viewed2888    
    Printed90    
    Emailed0    
    PDF Downloaded15    
    Comments [Add]    

Recommend this journal