|
 
 |
| CASE REPORT |
|
| Year : 2017 | Volume
: 19
| Issue : 1 | Page : 62-65 |
|
Aspergillus quadrilineatus infection in an elderly debilitated patient
N Chadiesh1, Bhavna T Jishnu2, Ananya Tupaki-Sreepurna2, R Ramanan3, Vijayakishore Thanneru2, Anupma Jyoti Kindo2
1 Department of Microbiology, Apollo Specialty Hospitals, Trichy, Tamil Nadu, India
2 Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Porur, Chennai, Tamil Nadu, India
3 Department of Pulmonology, Apollo Specialty Hospitals, Trichy, Tamil Nadu, India
| Date of Web Publication | 15-Jun-2017 |
Correspondence Address:
Anupma Jyoti Kindo
Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Porur, Chennai - 600 016, Tamil Nadu
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/jacm.jacm_7_17
We report a case of Aspergillus quadrilineatus isolated from post-tracheostomy bronchial wash sample of an 85-year-old hypertensive male admitted in the Intensive Care Unit with subarachnoid haemorrhage and low Glasgow Coma Scale score. Although the patient had a history of nasal infection and was symptomatic at the time of admission, the radiological findings were non-specific and included pulmonary infiltrates. This could be the first probable case of invasive infection by A. quadrilineatus reported from India. The patient was treated successfully with Itraconazole and was discharged after recovery from his illness. Keywords: Aspergillus quadrilineatus, Itraconazole, pulmonary aspergillosis
How to cite this article:
Chadiesh N, Jishnu BT, Tupaki-Sreepurna A, Ramanan R, Thanneru V, Kindo AJ. Aspergillus quadrilineatus infection in an elderly debilitated patient. J Acad Clin Microbiol 2017;19:62-5 |
How to cite this URL:
Chadiesh N, Jishnu BT, Tupaki-Sreepurna A, Ramanan R, Thanneru V, Kindo AJ. Aspergillus quadrilineatus infection in an elderly debilitated patient. J Acad Clin Microbiol [serial online] 2017 [cited 2022 Aug 17];19:62-5. Available from: https://www.jacmjournal.org/text.asp?2017/19/1/62/208084 |
| Introduction | |  |
Aspergillus species cause a wide spectrum of infections including cutaneous manifestations, otomycosis and invasive infections such as pulmonary aspergillosis and endocarditis. Pulmonary aspergillosis may range from invasive pulmonary aspergillosis (IPA) in severely immunocompromised patients and chronic necrotising aspergillosis in moderately immunocompromised population to allergic bronchopulmonary aspergillosis in the immunocompetent patients. The risk of IPA appears to be much higher in hematopoietic stem cell transplant patients and in patients with leukaemia, where the attributable mortality rate is 38.5%.[1] A. fumigatus remains the predominant agent of IPA, followed by either Aspergillus terreus or Aspergillus flavus depending on the medical centre.[2] Recently, IPA due to Aspergillus ustus and other rare aspergilli such as Aspergillus alliaceus,[3] Aspergillus lentulus[4] and Aspergillus udagawae[5] have been reported.
Clinically, identification of unknown aspergilli from clinical isolates up to species level may be important given that different species have variable susceptibilities to multiple antifungal drugs. Thus, knowledge of the species may influence the choice of appropriate antifungal therapy.In vitro and in vivo studies have demonstrated that A. terreus isolates are largely resistant to the antifungal drug Amphotericin B. A. ustus isolates appear to be refractory to azoles, and A. lentulus have low in vitro susceptibilities to a wide range of antifungals including Amphotericin B, azoles and echinocandins.[3],[4]
| Case Report | | |
An 86-year-old hypertensive, euglycaemic man was brought to the hospital in an unconscious state by his relatives. He was admitted to the Intensive Care Unit. There was no history of weakness or deviation of angle of mouth, but he had a history of urinary incontinence. The patient was given symptomatic treatment and regained consciousness after two days. He had history of nasal infection a few months back and had also undergone prostate and cataract surgery a few years ago.
On admission, his Glasgow Coma Scale (GCS) was found to be low 8/15 (E1V2M5, E-Eye opening, V-Response to verbal command, M-Motor response). He was drowsy, irritable and had minimal eye opening with painful stimuli. His pulse rate was 70/min and blood pressure was 130/80 mmHg. His systemic examination was normal. His computerised tomography image without contrast showed left thalamic bleed with intraventricular haemorrhage in occipital horns of both the lateral ventricles. He was diagnosed with left frontal and both parietal subarachnoid haemorrhage. There was no obvious increase in the size of haemorrhage over his period of hospital stay.
In view of low GCS, the patient was tracheostomised and supportive care was given. He was managed conservatively with Ryle's tube feeds, neuroprotective and antihypertensive drugs and physiotherapy. The patient was maintaining saturation with a SpO2 100% with 4 L of oxygen. Bronchoscopy was done to rule out fungal infection, and the bronchial wash was received in the diagnostic microbiology laboratory for culture and sensitivity.
The 10% potassium hydroxide mount of the sample showed septate fungal hyphae. Bronchial wash fluid was inoculated simultaneously in two sets of Sabouraud's Dextrose Agar (SDA) slant and incubated at 37°C and 25°C.
After 72 h of incubation, a white cottony growth was seen on the SDA slant. Macroscopically, the isolate on Czapek Dox Agar culture at 25°C showed floccose growth with feathery margins, with a creamy white obverse and yellowish reverse pigmentation [Figure 1]. Microscopically, we were able to appreciate the presence of ascospores within the ascus (sac) [Figure 2] and Hülle cells [Figure 3]. Our isolate appeared to be biseriate [Figure 4]. Aspergillus nidulans is also known to be biseriate. The conidial structures of Aspergillus quadrilineatus are not significantly different from those of A. nidulans, although the length of conidiophores may tend to be slightly shorter in the former species.[6] This characteristic feature is unreliable for the differentiation of the two species since the ranges of the conidiophore lengths for the species overlap. The only reliable characteristic for the separation of the two species is the number of equatorial crests on the ascospores which is identified in the electron microscope.[7] A slide culture was put up to identify the undisturbed morphology of the mold. The isolate was reported as Aspergillus species by conventional method and the patient who was initially started on Fluconazole was changed to Itraconazole therapy. The patient was hemodynamically stable on discharge and advised to follow up after three days. | Figure 1: Czapek Dox Agar showing (a) floccose growth with feathery margins on obverse (b) yellowish pigmentation on reverse
Click here to view |
 | Figure 3: Hülle cells with ascospores of Aspergillus quadrilineatus (×400)
Click here to view |
 | Figure 4: Lactophenol cotton blue mount showing biseriate conidiophore of Aspergillus quadrilineatus (×400)
Click here to view |
The morphology of the genus Aspergillus did not fit into any of the common species causing infection. The isolate was sent to Mycology Laboratory, Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Chennai for molecular identification. DNA extraction was done directly from the culture plate by an in-house column based method. Polymerase chain reaction (PCR) amplification was done using the pan-fungal primers ITS1 and ITS4. Sequencing of the PCR product was done at SciGenom Labs Pvt. Ltd., Cochin Kerala. Using NCBI nucleotide BLAST, the sequence was matched 100% with A. quadrilineatus strain ATCC 16816. The sequence was deposited with the NCBI Genbank database with accession number KX683008.
BTJ.1_ITS.forward_30631-1_8914, Trimmed Sequence (506bp) CTCCCACCCGTGA CTACCTAACACTGTTGCTTCGGCGGG GGACCACTGAACTTCATGCCTGAGAGTGATGC AGTCTGAGCCTGAATACAAATCAGTCA AAACTTTCAACAATGGATCTCTTGG TTCCGGCATCGATGAAGAACGCAGCGAA CTGCGATAAGTAATGTGAATTGCAGAATTCAG TGAATCATCGAGTCTTTGAACGCACATT GCGCCCCCTGGCATTCCGGGGGGCA TGCCTGTCCGAGCGTCATTGC TGCCCTCAAGCCCGGCTTGTGTGTTG TTTGTCACCCGCTCGATTAGGGCCGGC CGGGCGCCAGCCGGCGTCTCCAACCTTATT TTTCTCAGGTTGACCTCGGATCAG GTAGGGATA CCCGCTGAACTTAAGCATAT CAATAAGCGGAGGA
The antifungal susceptibility testing of the isolate was done according to the CLSI M38-A2 guidelines which showed a low minimal inhibitory concentration of 0.625 μg/ml for Amphotericin B, Posaconazole, Itraconazole, Voriconazole, and Caspofungin. Patient improved with Itraconazole 200 mg twice daily for 21 days.
| Discussion | | |
Cases of pulmonary aspergillosis are commonly due to A. fumigatus and A. flavus. A. quadrilineatus is a soil fungus that occurs mostly in dry, warm soil.[6] Clinical cases in India can occur because of the conducive soil and climatic conditions. Emericella quadrilineata (teleomorph stage) have large spores and adhere better to smooth surfaces. They have been identified on the smooth walls on sports showers. The asexual (anamorph) stage, i.e., Aspergillus quadrlineatus have smaller conidia and adhere better to rough surfaces.[8] The spores have also been found on the walled surfaces and air in school buildings.[8] Invasive infections with A. quadrilineatus are uncommon in humans. The first reported case of human infection was of sinusitis in 1992.[9] In India, A. quadrilineatus has been reported to cause onychomycosis and sinusitis in a patient with hematological malignancy.[7] Cases of invasive aspergillosis caused by Emericella species were first reported in 2008.[10] To the best of our knowledge, this is the first case of invasive A. quadrilineatus infection to be reported from India. Hence, we went ahead with molecular methods for unambiguous species identification. The application of molecular methods in addition to morphological identification aided in describing the role of A. quadrilineatus as an opportunistic pathogen. Use of these techniques helps to identify and discriminate more accurately within the numerous closely related fungal species and gives one a better insight into the pathogenesis of fungal infection.
The patient was suspected to have pulmonary Aspergillosis as per the chest X-ray findings showing pulmonary infiltrates and recovered with Itraconazole therapy [Figure 5]. We were unable to obtain a repeat sample as the patient was discharged on recovery.
| Conclusion | | |
We report a case of A. quadrilineatus isolated from the bronchial wash of an elderly hypertensive male with subarachnoid haemorrhage. A careful history along with radiological findings and the microbiological diagnosis was helpful in this situation. Demonstration of fungal hyphae or fungal culture positivity and identification of the fungus can help in early treatment with appropriate antifungal agents and hence decrease the morbidity and mortality of the patients. The rare species that we report here was identified using a combination of morphological and molecular techniques.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Balajee SA, Houbraken J, Verweij PE, Hong SB, Yaghuchi T, Varga J, et al. Aspergillus species identification in the clinical setting. Stud Mycol 2007;59:39-46.  |
| 2. | Balajee SA, Houbraken J, Verweij PE, Hong SB, Yaghuchi T, Varga J, et al. Aspergillusspecies identification in the clinical setting. Stud Mycol 2007;59:39-46. |
| 3. | Balajee SA, Lindsley MD, Iqbal N, Ito J, Pappas PG, Brandt ME. Nonsporulating clinical isolate identified as Petromyces alliaceus (anamorph Aspergillus alliaceus) by morphological and sequence-based methods. J Clin Microbiol 2007;45:2701-3. |
| 4. | Balajee SA, Gribskov JL, Hanley E, Nickle D, Marr KA. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot Cell 2005;4:625-32. |
| 5. | Balajee SA, Nickle D, Varga J, Marr KA. Molecular studies reveal frequent misidentification of Aspergillus fumigatus by morphotyping. Eukaryot Cell 2006;5:1705-12. |
| 6. | Raper KB, Fennell DI. The genus Aspergillus. Baltimore, MD: Williams and Wilkins Co.; 1965. |
| 7. | Sharma D, Capoor MR, Ramesh V, Gupta S, Shivaprakash MR, Chakrabarti A. A rare case of onychomycosis caused by Emericella quadrilineata ( Aspergillus tetrazonus). Indian J Med Microbiol 2015;33:314-6. [ PUBMED] [Full text] |
| 8. | Ejdys E. Fungi isolated in school buildings. Acta Mycol 2007;42:245-254. |
| 9. | Polacheck I, Nagler A, Okon E, Drakos P, Plaskowitz J, Kwon-Chung KJ. Aspergillus quadrilineatus, a new causative agent of fungal sinusitis. J Clin Microbiol 1992;30:3290-3. |
| 10. | Verweij PE, Varga J, Houbraken J, Rijs AJ, Verduynlunel FM, Blijlevens NM, et al. Emericella quadrilineata as cause of invasive aspergillosis. Emerg Infect Dis 2008;14:566-72. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
|
Search Pubmed for